Non-Sequitur Showdown.

For all your silly time-killing forum games.

Moderators: jestingrabbit, Moderators General, Prelates

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Mon Jan 22, 2018 1:31 am UTC

And then, with one swift motion, she leapt across the river to the other shore.

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Mon Jan 22, 2018 1:33 am UTC

Diana's mother in mythology gave birth to her daughter by herself, and then like, walked across seas and like... made a special island where they lives now? I am not citing sources for that I just heard it once.
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Mon Jan 22, 2018 1:51 am UTC

I'm all out of tea right now. Would you like some coffee?

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Mon Jan 22, 2018 3:03 am UTC

Why yes. I'd love some coffee. *Makes coffee and puts one teaspoon of sugars on it. Mixes lightly. Takes a sips.* Good. Now my non-sequitur: I graduated from Dalaran Ivy League Colleges and can cast TWO Pyroblasts and then Shimmer twice away before anyone hits me back and that's... not breaking the rules of role plays. </3
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Mon Jan 22, 2018 6:45 am UTC

I could train a bench.
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Mon Jan 22, 2018 7:11 am UTC

I could never, ever, lift fifty pounds of weight comfortably. And I weigh... more than fifty pounds. What a non-sequitur?
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Mon Jan 22, 2018 7:58 am UTC

Don't forget me!
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Mon Jan 22, 2018 4:17 pm UTC

It is said that semantically-flexible protocols, which span multiple levels of typological hierarchy, are principally rooted in the conceptual toolbox of negotiation theory. Using the method of restricting orthogonally-disjoint definitions to produce a non-orthogonal compound, we can therefore generalize the methodological inclusion relation established previously over trees to alternative relations which are capable of representing all directed acyclic graphs, albeit with reduced encoding efficiency for the common sub-elements. We then apply this new model, in conjunction with the "Nonlinearity of environments" model of path-dependence in cultural evolution, to explain the variability of staging layers in currently-existing general-purpose algebraic derivation systems, which so far have all suffered from the same limitations in terms of inter-interpretational composability and stateless representation of probabilistic functors. Finally, we propose a framework for designing future systems which resolve these issues by including mechanisms for embedding arbitrary predicates over the behavioral state of the system into the computational meta-description of the system on multiple levels of homomorphic encoding.

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Tue Jan 23, 2018 11:41 am UTC

Post above be hitting my nerdy fetishes buttons hard. *Pants a bit, cleans up her face and slides out the door to... collect herself.* Non sequitur: I CAN'T FIND MY KEYS. I know I had them when I was on Coruscant. Where in my spaceship could they be?
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Tue Jan 23, 2018 1:04 pm UTC

Pepper Rooney.
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Wed Jan 24, 2018 1:26 am UTC

You approach a fork in the road. You must choose your path wisely, lest great peril befall you.

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Wed Jan 24, 2018 1:49 am UTC

*Doorbell rings, you answer and: There's a pizza delivery girl.* I hear you ordered a philosophy pizza w/extra solipsism?
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Wed Jan 24, 2018 1:56 am UTC

"I'm on Mars again?", said the psychic turnip.

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Wed Jan 24, 2018 6:46 am UTC

Hip hip olé!
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Wed Jan 24, 2018 7:29 am UTC

Ariel w/hipstress glasses on is very, very disappoint in Everyone. 'Cause like she a philosophies AND sciences double major. So she thinks she's got both logic And feelings cornered and she... likes to be disappointed in ppls, 'cause like, it fuels her fires inside of her to be better, more elite and prettier and nerdier than EVERY. ONE. So she... is gonna make a one-liner sarcastic remark, flip her red hair and then flounce on out laughing at y'all... and me.
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Wed Jan 24, 2018 7:55 am UTC

sweaty
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Wed Jan 24, 2018 4:14 pm UTC

I put on my robe and wizard hat.

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Wed Jan 24, 2018 5:02 pm UTC

I cast Prismatic Barriers and Magic Missiles to DECIMATE the opposing black dragon queenie.
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Wed Jan 24, 2018 8:03 pm UTC

ATCCATGCCAACTGCTTAGGATAGGAGTGTGCACAATGATGGATCACCAACCAAGCAAAGCGGTGCTGCGGTCAACGAGAGTTAACTAGCGCAGAAAAGA

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Wed Jan 24, 2018 8:12 pm UTC

boop
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Wed Jan 24, 2018 8:17 pm UTC

Phantasm - JEJ15062*(&Δ"mɸ)[null]=\primary :: exists{enclosed?}

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Wed Jan 24, 2018 8:38 pm UTC

zzp
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Wed Jan 24, 2018 11:38 pm UTC

You look like you've seen a ghost!

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Thu Jan 25, 2018 6:25 am UTC

And mistletoe and cherries.
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Thu Jan 25, 2018 12:58 pm UTC

Kissing under the mistletoe at Christmas... hope my GF brushes her teeth before she get under that mistletoe... and cherries? They are so, so goody but can go straight to H-E-Double Hockey Sticks. </3 :(
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Thu Jan 25, 2018 12:59 pm UTC

Remember to dream.

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Thu Jan 25, 2018 1:02 pm UTC

? wrote:!
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Fri Jan 26, 2018 11:36 am UTC

That was a rhetorical question :roll:

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Fri Jan 26, 2018 1:03 pm UTC

Tick goes the tock.
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Sat Jan 27, 2018 7:53 am UTC

Tick-tock on the clock but the party don't stop, no... A song by Ke$ha.
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Sat Feb 03, 2018 8:35 pm UTC

Departure

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Sat Feb 03, 2018 9:21 pm UTC

This one better be more fluffy than the last one.
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Sun Feb 04, 2018 5:17 am UTC

Vriska the spider/troll woman wins ALL OF THE ROLE PLAYS. All of them true facts. <3 You Vriska... even though you abusive, abrasive, aggressive as f-f bomb.
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Sun Feb 04, 2018 5:33 pm UTC

SOAKED IN WOOD
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Sun Feb 04, 2018 6:58 pm UTC

Which of the following is not a noble gas:
a) Argon
b) Radon
c) Helium
d) Xenоn
e) Neon
f) Krypton

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Sun Feb 04, 2018 7:00 pm UTC

Steals a leg, any size
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Sun Feb 04, 2018 10:43 pm UTC

Pure.pow la letuo porque iq a40û app?

User avatar
Ginger
Posts: 1029
Joined: Thu Sep 04, 2008 10:00 am UTC

Re: Non-Sequitur Showdown.

Postby Ginger » Mon Feb 05, 2018 6:20 am UTC

I Had endless, eternity cosmetic surgeries, beauty products apply to my hair and face to... be your perfect love doll date happy birthday. <3 *Creepy emptily prettily smiles at her dates.*
Amy Lee wrote:Just what we all need... more lies about a world that never was and never will be.


Azula to Long Feng wrote:Don't flatter yourself, you were never even a player.

User avatar
flicky1991
Like in Cinderella?
Posts: 720
Joined: Fri Feb 11, 2011 3:36 pm UTC
Location: London

Re: Non-Sequitur Showdown.

Postby flicky1991 » Mon Feb 05, 2018 6:43 am UTC

nyarn
any pronouns
----
Forum Games Discord
(tell me if link doesn't work)

User avatar
faubi
Posts: 6
Joined: Sat Dec 23, 2017 11:50 pm UTC
Location: UTC-5
Contact:

Re: Non-Sequitur Showdown.

Postby faubi » Mon Feb 05, 2018 3:14 pm UTC

colonizers colonizes colonies colones colons colon coon coo co
splittings splitting spitting spiting siting sting sing sin in
composers composer compose compos compo comp com co
trappings trapping tapping taping aping ping pin pi
scrapping crapping rapping raping aping ping pin pi
groupings grouping groping roping oping ping pin pi
wrappings wrapping rapping raping aping ping pin pi
spritzers spritzes sprites sprite spite spit sit st
strapping trapping tapping taping aping ping pin pi
tramplers trampler tramper tamper tamer tame tam ta
trampling tramping tamping taping aping ping pin pi
starvings starving staring string sting sing sin in
roadsters roadster roaster raster rater rate rat rt
stampeded stampede stamped tamped tamed tame tam ta
preachers preaches peaches peaces peace pace ace ac
carousels carousel carouse arouse arose rose roe re
starlings starling staring string sting sing sin in
cleansers cleanser cleanse cleans clean clan can ca
flashiest flashest flashes lashes lases lass ass as
prattlers prattler rattler ratter rater rate rat rt
splatters splatter platter latter latte late lat la
stampedes stampede stamped tamped tamed tame tam ta
scrappers scrapper scraper scrape scrap crap cap ca
stringier stringer stinger singer singe sing sin in
splitting spitting spiting siting sting sing sin in
discusses discuses discuss discus discs disc dis is
twaddling waddling wadding adding dding ding din in
composted composed compose compos compo comp com co
carousers carouser carouse arouse arose rose roe re
suppliers supplier suppler supple suppl supp sup up
sparkling sparking sparing spring sprig prig pig pi
drownings drowning downing owning owing wing win in
stringers stringer stinger singer singe sing sin in
prickling pricking picking piking piing ping pin pi
paintings painting paining pining piing ping pin pi
startling starting staring string sting sing sin in
grumblers grumbler grumble rumble ruble rube rue re
colonizes colonies colones colons colon coon coo co
swaddling saddling addling adding dding ding din in
piercings piercing piecing pieing piing ping pin pi
restarted restated restate estate state stat sat st
switchers switches witches withes withe with wit wt
ministers minister minster minter miner mine min mi
thrashers thrashes trashes rashes ashes shes she sh
scrappier scrapper scraper scrape scrap crap cap ca
drowning downing owning owing wing win in
masterly mastery master mater mate mat ma
sheathed sheathe sheath heath heat hat ha
throwing trowing towing owing wing win in
pasterns pastern astern stern tern ten tn
streamed steamed teamed tamed tame tam ta
troupers trouper troupe trope rope roe re
whopping hopping hoping oping ping pin pi
testates testate estate state stat sat st
cropping copping coping oping ping pin pi
carriers carries caries cares care car ca
crumbled crumble rumble ruble rube rue re
trampers tramper tamper tamer tame tam ta
smoothed soothed soothe sooth soot sot so
leathery leather lather lathe lath lat la
minister minster minter miner mine min mi
stamping tamping taping aping ping pin pi
sparring sparing spring sprig prig pig pi
rattlers rattler ratter rater rate rat rt
smoother soother soothe sooth soot sot so
presents present preset reset rest res re
blooping looping loping oping ping pin pi
flashest flashes lashes lases lass ass as
clatters clatter latter latte late lat la
brattier rattier ratter rater rate rat rt
chanters chanter canter caner cane can ca
chomping comping coping oping ping pin pi
spilling pilling piling piing ping pin pi
doggiest doggies dogies dogie doge dog do
rewarmed rearmed reared rared rare are re
starling staring string sting sing sin in
shitting sitting siting sting sing sin in
whooping hooping hoping oping ping pin pi
bearings bearing baring bring brig big bi
blasters blaster baster baste bast bat at
swingers swinger singer singe sing sin in
coursers courser course curse curs cur cu
martinis martins matins mains main man ma
prattled rattled ratted rated rate rat rt
sittings sitting siting sting sing sin in
blushing bushing busing using sing sin in
scrapper scraper scrape scrap crap cap ca
cleanser cleanse cleans clean clan can ca
Martians Martian Martin Marin Mari Mar Mr
shinnied shinned shined shine shin sin in
scantily scantly scanty scant scan can ca
sparking sparing spring sprig prig pig pi
shatters shatter hatter hater hate hat ha
inspects inspect insect inset inst ins in
pastiest pasties pastie paste past pas pa
forgoers forgoer forger forge fore for fr
plungers plunger plunge lunge lung lug lg
carouses carouse arouse arose rose roe re
palpates palpate palate plate plat pat pa
sparsest sparest spares spare spar spa pa
gravelly gravely gravel grave gave ave av
trackers tracker tracer trace race ace ac
triplets triplet triple tripe trip tip ti
platters platter latter latte late lat la
colognes colones colons colon coon coo co
sparkled sparked spared spare spar spa pa
colonies colones colons colon coon coo co
bushings bushing busing using sing sin in
carouser carouse arouse arose rose roe re
spooring sporing spring sprig prig pig pi
chattier chatter hatter hater hate hat ha
restates restate estate state stat sat st
washiest ashiest shiest shies shes she sh
cruddier ruddier rudder ruder rude rue re
slathers slather lather lathe lath lat la
revilers reviler eviler viler vile vie vi
painting paining pining piing ping pin pi
cruisers cruiser cruise cruse ruse rue re
stingers stinger singer singe sing sin in
catchers catches caches cache ache ace ac
flattery flatter latter latte late lat la
browsers browser browse brows brow bow ow
caroused carouse arouse arose rose roe re
trampled tramped tamped tamed tame tam ta
spritzes sprites sprite spite spit sit st
splashed slashed lashed ashed shed she sh
cremated cremate create crate rate rat rt
soothers soother soothe sooth soot sot so
granting grating gratin grain gran ran an
tranches tranche trance trace race ace ac
stampede stamped tamped tamed tame tam ta
bitterns bittern bitter biter bite bit bi
abridged abridge bridge bride bide bid bi
twinkled winkled winked wined wine win in
splashes slashes sashes ashes shes she sh
slithery slither lither lithe lite lit it
scarpers scarper carper carer care car ca
amorally morally orally rally ally all ll
Marianas Mariana Marian Maria Mari Mar Mr
composer compose compos compo comp com co
brindled brindle bridle bride bide bid bi
spoiling soiling soling sling sing sin in
growling growing rowing owing wing win in
loungers lounger lounge lunge lung lug lg
crowding crowing cowing owing wing win in
tromping romping roping oping ping pin pi
blushers blusher lusher usher user use us
statutes statute statue state stat sat st
choosier chooser choose chose hose hos ho
trapping tapping taping aping ping pin pi
wrinkled winkled winked wined wine win in
aglitter glitter litter liter lite lit it
scowling cowling cowing owing wing win in
brushing bushing busing using sing sin in
pricking picking piking piing ping pin pi
phoniest phonies phones phone pone one on
preaches peaches peaces peace pace ace ac
grippers gripers gripes grips rips rps rs
tramping tamping taping aping ping pin pi
theaters theater heater hater hate hat ha
prickers pricker picker piker pike pie pi
cremates cremate create crate rate rat rt
twaddled waddled wadded waded wade wad ad
shifting sifting siting sting sing sin in
starting staring string sting sing sin in
heaviest heavies heaves heave have ave av
scorners scorner scorer score sore ore or
groupers grouper groper grope rope roe re
planters planter planer plane plan pan pa
pastimes pastime pastie paste past pas pa
brashest rashest rashes ashes shes she sh
heroines heroine heroin heron hero her he
crumbles crumble rumble ruble rube rue re
remotest remotes remote emote mote mot mo
boarders boarder border borer bore ore or
couplets couplet couple coupe coup cop co
relapses relapse elapse lapse laps lap la
coasters coaster caster caste cast cat ca
grafters grafter grater grate gate ate at
pickling picking piking piing ping pin pi
sharpers sharper sharer share hare are re
cleansed cleanse cleans clean clan can ca
barrings barring baring bring brig big bi
grouping groping roping oping ping pin pi
sedating seating sating sting sing sin in
mortally morally orally rally ally all ll
gyrating grating gratin grain gran ran an
crappers rappers rapers rapes raps rps rs
splatted slatted slated slate slat sat st
grumbles grumble rumble ruble rube rue re
slitting sitting siting sting sing sin in
stripped striped stripe strip trip tip ti
sweating seating sating sting sing sin in
starters starter starer stare star tar ta
champers campers camper caper cape cap ca
gratings grating gratin grain gran ran an
stolider solider slider slide slid lid id
strewing stewing sewing swing sing sin in
bearding bearing baring bring brig big bi
atheists atheist theist heist hist his hi
flatters flatter latter latte late lat la
splatter platter latter latte late lat la
scourers scourer scorer score sore ore or
composed compose compos compo comp com co
bluefish blueish bluish blush bush bus bu
wrapping rapping raping aping ping pin pi
chorales chorale choral coral coal col co
colonels colones colons colon coon coo co
crapping rapping raping aping ping pin pi
saluting salting sating sting sing sin in
manglers mangler mangle mange mane man ma
deprives deprive derive drive dive div iv
bouncier bouncer bounce bonce bone one on
glitters glitter litter liter lite lit it
cleanses cleanse cleans clean clan can ca
prospers prosper proper roper rope roe re
spearing sparing spring sprig prig pig pi
faintest fainest finest fines fine fin in
scampers scamper camper caper cape cap ca
unitizes unities unites unite unit nit it
scantier scanter canter caner cane can ca
primping pimping piping piing ping pin pi
minsters minster minter miner mine min mi
charters charter carter carer care car ca
statuses statues statue state stat sat st
slashers slashes sashes ashes shes she sh
whingers whinger whinge whine wine win in
chatters chatter hatter hater hate hat ha
plushier plusher pusher usher user use us
clutters clutter cutter cuter cute cut cu
espoused espouse spouse souse sous sou so
prawning pawning pawing awing wing win in
switches witches withes withe with wit wt
pickings picking piking piing ping pin pi
starving staring string sting sing sin in
sheathes sheathe sheath heath heat hat ha
loathers loather loathe loath lath lat la
swaddled waddled wadded waded wade wad ad
drinkers drinker dinker diner dine din in
granters granter grater grate gate ate at
modestly modesty modest modes mode mod mo
reflated reflate relate elate late lat la
restated restate estate state stat sat st
crushers crusher rusher usher user use us
dossiers dossers dosses doses dose dos do
glittery glitter litter liter lite lit it
grandeur grander grader grade grad gad ad
drafters drafter dafter dater date ate at
pastries pasties pastie paste past pas pa
thrilled trilled tilled tiled tile til ti
prattler rattler ratter rater rate rat rt
coroners coroner corner corer core cor co
discuses discuss discus discs disc dis is
shearers shearer sharer share hare are re
chastens chasten chaste caste cast cat ca
managers manager manage mange mane man ma
bouncers bouncer bounce bonce bone one on
drowsing dowsing dosing doing dong don do
marchers marches arches aches ache ace ac
smashers smashes sashes ashes shes she sh
braceros bracero bracer brace race ace ac
stingier stinger singer singe sing sin in
carousel carouse arouse arose rose roe re
crowning crowing cowing owing wing win in
princess princes prices pries pres res re
clopping copping coping oping ping pin pi
wrappers rappers rapers rapes raps rps rs
Jeannine Jeannie Jeanie Janie Jane Jan an
portends portend ported pored pore ore or
leathers leather lather lathe lath lat la
adverser adverse averse avers aver ave av
roadster roaster raster rater rate rat rt
piercing piecing pieing piing ping pin pi
relapsed relapse elapse lapse laps lap la
stringer stinger singer singe sing sin in
gamblers gambles gables gales gals gas gs
crackled cracked racked raced race ace ac
startled started stared stare star tar ta
starring staring string sting sing sin in
scourged scoured scored score sore ore or
bustiest busiest busies buses buss bus bu
cheaters cheater heater hater hate hat ha
strikers strikes trikes tries ties tie ti
bewaring bearing baring bring brig big bi
plopping lopping loping oping ping pin pi
bushiest busiest busies buses buss bus bu
swatches swathes swathe swath swat sat st
snorters snorter snorer snore sore ore or
foragers forager forage forge fore for fr
boasters boaster baster baste bast bat at
grousers grouser grouse rouse roue roe re
strapped trapped tapped taped tape tap ta
starkers starker starer stare star tar ta
espouses espouse spouse souse sous sou so
cowlings cowling cowing owing wing win in
gaminess gamines gamine gamin gain gin in
bursting busting busing using sing sin in
thrashes trashes rashes ashes shes she sh
reflates reflate relate elate late lat la
abridges abridge bridge bride bide bid bi
supplier suppler supple suppl supp sup up
blathers blather bather bathe bath bat at
statures stature statue state stat sat st
gestated gestate estate state stat sat st
flopping lopping loping oping ping pin pi
honestly honesty honest hones hone hon ho
sporting sporing spring sprig prig pig pi
waddling wadding adding dding ding din in
moussing mousing musing using sing sin in
singlets singlet single singe sing sin in
roasters roaster raster rater rate rat rt
Friedman Friedan Frieda Freda Fred Fed Fe
prickled pricked priced pried pied pie pi
ashtrays ashtray astray stray stay sty st
prelates prelate relate elate late lat la
foregoes forgoes forges forge fore for fr
twitches witches withes withe with wit wt
cleavers cleaver cleave leave lave lav la
shingled shingle single singe sing sin in
spitting spiting siting sting sing sin in
scooping scoping coping oping ping pin pi
spinning pinning pining piing ping pin pi
palpated palpate palate plate plat pat pa
gestates gestate estate state stat sat st
relaters relater relate elate late lat la
chopping copping coping oping ping pin pi
paddling padding adding dding ding din in
slithers slither lither lithe lite lit it
draftier drafter dafter dater date ate at
trappers trapper tapper taper tape tap ta
choosers chooser choose chose hose hos ho
grumbled grumble rumble ruble rube rue re
grumbler grumble rumble ruble rube rue re
Marciano Mariano Marian Maria Mari Mar Mr
clomping comping coping oping ping pin pi
saddling addling adding dding ding din in
grasping gasping gaping aping ping pin pi
martians martins matins mains main man ma
trampler tramper tamper tamer tame tam ta
stampers stamper tamper tamer tame tam ta
abounded bounded bonded boned bone one on
planners planner planer plane plan pan pa
slanting slating sating sting sing sin in
shingles shingle single singe sing sin in
splicers splicer splice spice spic pic pi
parolees parolee parole prole pole pol pl
grafting grating gratin grain gran ran an
composes compose compos compo comp com co
switched witched withed withe with wit wt
scurries curries curies curie cure cur cu
storming storing string sting sing sin in
bustling busting busing using sing sin in
twitched witched withed withe with wit wt
deprived deprive derive drive dive div iv
composts compost compos compo comp com co
flashers flashes lashes lases lass ass as
slopping sloping loping oping ping pin pi
showings showing sowing swing sing sin in
shopping hopping hoping oping ping pin pi
spawning pawning pawing awing wing win in
scrapped scraped scrape scrap crap cap ca
scrapers scraper scrape scrap crap cap ca
testate estate state stat sat st
drafter dafter dater date ate at
curries curies curie cure cur cu
clacked lacked laced lace lac la
slitter litter liter lite lit it
testers testes tests test est es
pricker picker piker pike pie pi
starers starer stare star tar ta
planned planed plane plan pan pa
snipers snipes snips sips sis is
sheared shared share hare are re
smelted melted meted mete met me
writhed writhe write writ wit wt
salting sating sting sing sin in
cheated heated hated hate hat ha
manager manage mange mane man ma
brogues brogue rogue roue roe re
winches winces wince wine win in
copying coping oping ping pin pi
pedalos pedalo pedal peal pea pa
strokes stroke stoke toke toe to
blobbed lobbed lobed lobe lob lo
mopping moping oping ping pin pi
pushier pusher usher user use us
roarers roarer rarer rare are re
gabbles gables gales gals gas gs
downers downer dower doer doe do
hatreds hatred hated hate hat ha
whooped hooped hoped hope hop ho
scalped scaled scald scad sad ad
twinged twinge twine twin tin ti
remoter remote emote mote mot mo
gnashes gashes ashes shes she sh
boarder border borer bore ore or
cleaved cleave leave lave lav la
lounger lounge lunge lung lug lg
pawning pawing awing wing win in
mousses mousse mouse muse mus mu
blasted basted baste bast bat at
solider slider slide slid lid id
trances trance trace race ace ac
storied stored store sore ore or
cruiser cruise cruse ruse rue re
suiting siting sting sing sin in
roaster raster rater rate rat rt
springs spring sprig prig pig pi
sporing spring sprig prig pig pi
springy spring sprig prig pig pi
grouped groped grope rope roe re
grovels grovel grove rove roe re
sexists sexist exist exit ext ex
gyrates gyrate grate gate ate at
hoisted hosted hosed hose hos ho
mushing musing using sing sin in
pastime pastie paste past pas pa
bearers bearer barer bare are re
writers writer write writ wit wt
bushing busing using sing sin in
frilled filled filed fled fed ed
tryouts tryout trout trot tot to
cachets cachet cache ache ace ac
stashes sashes ashes shes she sh
barkers barker barer bare are re
flailed failed filed fled fed ed
pilling piling piing ping pin pi
forgets forget forge fore for fr
sheaved sheave shave save ave av
clamped camped caped cape cap ca
swathed swathe swath swat sat st
malteds malted mated mate mat ma
classes lasses lases lass ass as
ashamed shamed shame sham ham ha
spewing sewing swing sing sin in
grooves groove grove rove roe re
wadding adding dding ding din in
resists resist resit rest res re
burrows burrow burro burr bur bu
refuses refuse reuse ruse rue re
halters halter hater hate hat ha
swathes swathe swath swat sat st
mousier mouser mouse muse mus mu
Pekings Peking eking king kin kn
snorers snorer snore sore ore or
whinges whinge whine wine win in
eastern astern stern tern ten tn
peaches peaces peace pace ace ac
adverse averse avers aver ave av
slashes sashes ashes shes she sh
gratins gratin grain gran ran an
clothed clothe cloth clot cot co
picking piking piing ping pin pi
grating gratin grain gran ran an
tripods tripos trips trip tip ti
trimmed rimmed rimed rime rim rm
planter planer plane plan pan pa
Mariana Marian Maria Mari Mar Mr
slashed lashed ashed shed she sh
ruddier rudder ruder rude rue re
dodgers dodger dodge doge dog do
mousers mouser mouse muse mus mu
paroles parole prole pole pol pl
screeds screed creed cred red re
spitted spited spite spit sit st
clammed lammed lamed lame lam la
carpets carpet caret care car ca
cutters cutter cuter cute cut cu
triplet triple tripe trip tip ti
drowned droned drone done don do
forager forage forge fore for fr
screams scream scram scam cam ca
debarks debark debar dear ear ea
routers router route rout rot rt
cranked craned crane cane can ca
spriest priest pries pres res re
skating sating sting sing sin in
starred stared stare star tar ta
forties fortes forte fort for fr
casters caster caste cast cat ca
compost compos compo comp com co
catches caches cache ache ace ac
Martina Martin Marin Mari Mar Mr
twinges twinge twine twin tin ti
forages forage forge fore for fr
assents assent asset asst ass as
flowing lowing owing wing win in
spoiled soiled soled sole sol so
twinned twined twine twin tin ti
mousing musing using sing sin in
spiting siting sting sing sin in
butties buttes butte butt but bu
exposed expose expos expo exp ex
motored moored mooed mood moo mo
busboys busboy busby busy bus bu
slopped sloped slope slop sop so
pleaded leaded laded lade lad la
rashers rashes ashes shes she sh
courser course curse curs cur cu
slither lither lithe lite lit it
snorter snorer snore sore ore or
grouser grouse rouse roue roe re
crusher rusher usher user use us
hardily hardly hardy hard had ha
amusing musing using sing sin in
sparser sparse spars spar spa pa
castled castle caste cast cat ca
singers singer singe sing sin in
regaled regale regal real rel re
piecing pieing piing ping pin pi
draping raping aping ping pin pi
painted pained pined pine pin pi
plunges plunge lunge lung lug lg
singles single singe sing sin in
hoovers hoover hover hove hoe ho
demoted demote emote mote mot mo
cravens craven crave cave ave av
bowling bowing owing wing win in
mangled mangle mange mane man ma
milkier milker miler mile mil mi
Marissa Marisa Maris Mari Mar Mr
slavers slaver slave save ave av
hatters hatter hater hate hat ha
blaster baster baste bast bat at
pranged ranged range rang ran an
scorers scorer score sore ore or
loathes loathe loath lath lat la
heavers heaver heave have ave av
witched withed withe with wit wt
scooped scoped scope cope cop co
blaring baring bring brig big bi
tarried tarred tared tare tar ta
strains strain train rain ran an
leavens leaven leave lave lav la
conveys coneys cones cone con co
spacier spacer space pace ace ac
drivers driver drive dive div iv
bounced bounce bonce bone one on
boasted boated bated bate bat at
mangers manger mange mane man ma
amnions amnion anion anon non no
Maurine Marine Marin Mari Mar Mr
rappers rapers rapes raps rps rs
splicer splice spice spic pic pi
princes prices pries pres res re
snowing sowing swing sing sin in
sourest sorest sores sore ore or
rapider raider rider ride rid rd
campers camper caper cape cap ca
forgery forger forge fore for fr
hearths hearth heart hear her he
barbing baring bring brig big bi
blusher lusher usher user use us
plaited plated plate plat pat pa
graters grater grate gate ate at
monists monist moist most mos mo
brushed bushed bused used use us
ablates ablate abate bate bat at
deprive derive drive dive div iv
mangeds manged mange mane man ma
scanned canned caned cane can ca
heroins heroin heron hero her he
rebuses reuses reuse ruse rue re
swanked wanked waned wane wan an
soothes soothe sooth soot sot so
metiers metier meter mete met me
champed camped caped cape cap ca
sparkly sparky spark spar spa pa
glinted linted lined lied lid id
glanced glance glace lace lac la
bridled bridle bride bide bid bi
slowing sowing swing sing sin in
platter latter latte late lat la
espouse spouse souse sous sou so
millers miller miler mile mil mi
smashed mashed ashed shed she sh
Maratha Martha Marta Mara Mar Mr
asserts assert asset asst ass as
crumble rumble ruble rube rue re
trotted totted toted tote tot to
stringy string sting sing sin in
tappers tapper taper tape tap ta
flamers flamer flame lame lam la
batched bathed bathe bath bat at
pipping piping piing ping pin pi
groused grouse rouse roue roe re
thereat threat treat teat tea ta
doggies dogies dogie doge dog do
courses course curse curs cur cu
coaster caster caste cast cat ca
tramped tamped tamed tame tam ta
pupated pupate pupae pupa pup pp
grafter grater grate gate ate at
priests priest pries pres res re
campier camper caper cape cap ca
timbers timber timer time tie ti
oranges orange range rang ran an
cashews cashes ashes shes she sh
praters prater prate prat pat pa
palates palate plate plat pat pa
flambes flambe flame lame lam la
singlet single singe sing sin in
aspires aspire spire sire ire re
forests forest fores fore for fr
bursars bursar bursa burs bur bu
stating sating sting sing sin in
derived derive drive dive div iv
rewarms rewarm rearm rear ear ea
raiders raider rider ride rid rd
scantly scanty scant scan can ca
minuted minted mined mine min mi
blushes bushes buses buss bus bu
cutlers cutler cuter cute cut cu
grafted grated grate gate ate at
chorale choral coral coal col co
buttery butter butte butt but bu
planner planer plane plan pan pa
solidus solids solid sold sol so
ghosted hosted hosed hose hos ho
rapiers rapers rapes raps rps rs
slammed lammed lamed lame lam la
smooths smooth sooth soot sot so
whiners whiner whine wine win in
clicked licked liked lied lid id
smartly smarty smart mart mar ma
dowsers dowser dowse dose dos do
plashes lashes lases lass ass as
stamper tamper tamer tame tam ta
belated elated elate late lat la
downing owning owing wing win in
carders carder carer care car ca
hearses hearse hears hear her he
trivets trivet rivet rive riv iv
fourths fourth forth fort for fr
browsed browse brows brow bow ow
mergers merger merge mere ere er
dolling doling doing dong don do
restate estate state stat sat st
mussing musing using sing sin in
larches arches aches ache ace ac
crooked cooked cooed coed cod co
rangier ranger range rang ran an
starker starer stare star tar ta
prosper proper roper rope roe re
coursed course curse curs cur cu
comping coping oping ping pin pi
tropics tropic topic topi top to
lancets lancet lance lace lac la
streaks streak steak teak tea ta
clonked cloned clone cone con co
hooping hoping oping ping pin pi
chooser choose chose hose hos ho
drovers drover drove dove doe do
tracery tracer trace race ace ac
flusher lusher usher user use us
curates curate crate rate rat rt
plopped lopped loped lope lop lo
stroked stroke stoke toke toe to
tracker tracer trace race ace ac
blither blithe lithe lite lit it
ashtray astray stray stay sty st
morally orally rally ally all ll
granges grange range rang ran an
chatted hatted hated hate hat ha
shearer sharer share hare are re
Johanna Johann Joann Joan Jon Jo
bustled busted bused used use us
plushly plushy plush plus pus us
finders finder finer fine fin in
scrawls scrawl crawl craw caw ca
tampers tamper tamer tame tam ta
rafters rafter rater rate rat rt
Friedan Frieda Freda Fred Fed Fe
Marxian Marian Maria Mari Mar Mr
friends friend fiend find fin in
creates create crate rate rat rt
loathed loathe loath lath lat la
dratted ratted rated rate rat rt
grouper groper grope rope roe re
curlers curler curer cure cur cu
boaster baster baste bast bat at
garbles gables gales gals gas gs
carvers carver carve care car ca
drivels drivel drive dive div iv
lobbied lobbed lobed lobe lob lo
scalded scaled scald scad sad ad
soothed soothe sooth soot sot so
busting busing using sing sin in
sheaves sheave shave save ave av
forgoes forges forge fore for fr
leashed leased lease leas lea la
scraper scrape scrap crap cap ca
healthy health heath heat hat ha
withers wither withe with wit wt
granted grated grate gate ate at
turners turner tuner tune tun tn
glandes glands gland glad gad ad
cumbers cumber cuber cube cub cu
starter starer stare star tar ta
sparest spares spare spar spa pa
valleys valley alley ally all ll
bridles bridle bride bide bid bi
rubiest rubies rubes rube rue re
opining pining piing ping pin pi
twilled tilled tiled tile til ti
estates estate state stat sat st
scanter canter caner cane can ca
whereas wheres where whee wee we
morsels morsel morel more ore or
shingle single singe sing sin in
cropped copped coped cope cop co
pinning pining piing ping pin pi
drowses drowse dowse dose dos do
clopped copped coped cope cop co
pleased please pleas plea pea pa
deports deport depot dept dpt pt
toothed tooted toted tote tot to
drogues drogue rogue roue roe re
shavers shaver shave save ave av
slavery slaver slave save ave av
dowries dories dries dies dis is
sharked shared share hare are re
dowsing dosing doing dong don do
kludges kludge kluge luge lug lg
battled batted bated bate bat at
cleanse cleans clean clan can ca
grilles grille grill gill ill ll
abreast breast beast beat bet be
statues statue state stat sat st
latches lathes lathe lath lat la
gravest graves grave gave ave av
strewed stewed steed teed ted ed
brawled bawled baled bald bad ad
stamped tamped tamed tame tam ta
plunger plunge lunge lung lug lg
leashes leases lease leas lea la
plunged plunge lunge lung lug lg
blueish bluish blush bush bus bu
brimmed rimmed rimed rime rim rm
deicers deices dices dies dis is
shewing sewing swing sing sin in
coaches caches cache ache ace ac
secants secant scant scan can ca
prelate relate elate late lat la
phonies phones phone pone one on
pesters pester peter peer per pr
acutest acutes acute cute cut cu
weavers weaver weave wave ave av
dinkier dinker diner dine din in
dossers dosses doses dose dos do
badgers badger badge bade bad ad
Bridges ridges ridge ride rid rd
whither whiter white whit wit wt
shticks shtick stick tick tic ti
portend ported pored pore ore or
reapers rapers rapes raps rps rs
castles castle caste cast cat ca
heaters heater hater hate hat ha
country county count cont con co
mintier minter miner mine min mi
nascent ascent scent sent sen en
salvers salver salve save ave av
awnings awning awing wing win in
tapping taping aping ping pin pi
carnies caries cares care car ca
pickier picker piker pike pie pi
elapsed elapse lapse laps lap la
stifled stifle stile tile til ti
loiters loiter liter lite lit it
spacers spacer space pace ace ac
twiners twiner twine twin tin ti
theists theist heist hist his hi
tranche trance trace race ace ac
bonnier bonier boner bone one on
rattler ratter rater rate rat rt
borders border borer bore ore or
clocked cocked coked coed cod co
leather lather lathe lath lat la
swinger singer singe sing sin in
fawning awning awing wing win in
dodgems dodgem dodge doge dog do
fainter fainer finer fine fin in
rattled ratted rated rate rat rt
waivers waiver waive wave ave av
passels passel passe pass pas pa
pimping piping piing ping pin pi
plaints plaint plain plan pan pa
rudders rudder ruder rude rue re
dancers dancer dance dace ace ac
rattier ratter rater rate rat rt
sharper sharer share hare are re
musings musing using sing sin in
craters crater crate rate rat rt
pruners pruner prune rune rue re
inserts insert inset inst ins in
feasted fasted fated fate fat fa
swerves swerve serve sere ere er
hoarser hoarse horse hose hos ho
soloing soling sling sing sin in
galleys galley alley ally all ll
braided raided aided aide aid ad
sloping loping oping ping pin pi
loather loathe loath lath lat la
modesty modest modes mode mod mo
shopped hopped hoped hope hop ho
glowing lowing owing wing win in
mashers mashes ashes shes she sh
stinger singer singe sing sin in
acutely cutely cutey cute cut cu
trailed tailed tiled tile til ti
gasping gaping aping ping pin pi
Bradley Bradly Brady Brad rad rd
natives native naive nave ave av
crashed cashed ashed shed she sh
Marines Marine Marin Mari Mar Mr
pedaled pealed paled pale pal pa
marches arches aches ache ace ac
littler litter liter lite lit it
scamper camper caper cape cap ca
blooped looped loped lope lop lo
staring string sting sing sin in
strikes trikes tries ties tie ti
rasping raping aping ping pin pi
rentals rental renal real rel re
grouses grouse rouse roue roe re
solving soling sling sing sin in
latched lathed lathe lath lat la
slacked lacked laced lace lac la
coupled couple coupe coup cop co
charter carter carer care car ca
strings string sting sing sin in
tingled tingle tinge ting tin ti
corrals corral coral coal col co
traders trader trade trad tad ta
scarcer scarce scare scar car ca
drafted rafted rated rate rat rt
diverts divert diver dive div iv
Mariano Marian Maria Mari Mar Mr
mantels mantes manes mane man ma
pilings piling piing ping pin pi
splashy splash slash sash ssh sh
wracked racked raced race ace ac
looping loping oping ping pin pi
abusing busing using sing sin in
twitchy twitch witch with wit wt
sharers sharer share hare are re
curated curate crate rate rat rt
Shelley Shelly Shell hell ell ll
mushers musher usher user use us
bittern bitter biter bite bit bi
cronies crones crone cone con co
cancers cancer caner cane can ca
troupes troupe trope rope roe re
clawing cawing awing wing win in
ratters ratter rater rate rat rt
crushes cruses cruse ruse rue re
chocked choked choke hoke hoe ho
rompers romper roper rope roe re
lancers lancer lance lace lac la
demotes demote emote mote mot mo
cardies caries cares care car ca
chopped copped coped cope cop co
reckons reckon recon econ eon en
parched arched arced aced ace ac
regally really rally ally all ll
shorter sorter sorer sore ore or
planets planet plane plan pan pa
fingers finger finer fine fin in
rashest rashes ashes shes she sh
exposes expose expos expo exp ex
divests divest dives dive div iv
crashes cashes ashes shes she sh
clarets claret caret care car ca
shifted sifted sited site sit st
clashes cashes ashes shes she sh
adverts advert avert aver ave av
pimpled pimped piped pipe pip pi
pleases please pleas plea pea pa
slating sating sting sing sin in
fussing fusing using sing sin in
blinked linked lined lied lid id
carpers carper carer care car ca
planers planer plane plan pan pa
shinned shined shine shin sin in
flouted fluted flute flue flu fl
bounces bounce bonce bone one on
palmate palate plate plat pat pa
minuter minter miner mine min mi
clothes clothe cloth clot cot co
heavier heaver heave have ave av
gyrated gyrate grate gate ate at
desists desist deist dist dis is
gravely gravel grave gave ave av
pushers pusher usher user use us
hawking hawing awing wing win in
despots despot depot dept dpt pt
soiling soling sling sing sin in
addling adding dding ding din in
tracked traced trace race ace ac
rumbles rumble ruble rube rue re
redcaps redcap recap reap rep re
lathery lather lathe lath lat la
flashes lashes lases lass ass as
primers primer prime prim rim rm
wanders wander wader wade wad ad
chaired haired hared hare are re
chapped capped caped cape cap ca
partied parted pared pare par pa
platted plated plate plat pat pa
knitted kitted kited kite kit kt
grilled grille grill gill ill ll
archest arches aches ache ace ac
stewing sewing swing sing sin in
yawning yawing awing wing win in
darters darter darer dare are re
bravery braver brave rave ave av
meowing mowing owing wing win in
gamines gamine gamin gain gin in
breasts breast beast beat bet be
dodgier dodger dodge doge dog do
related relate elate late lat la
foraged forage forge fore for fr
brushes bushes buses buss bus bu
grooved groove grove rove roe re
cleaver cleave leave lave lav la
parches arches aches ache ace ac
crowing cowing owing wing win in
chewers chewer hewer ewer ewe we
pearled pealed paled pale pal pa
byroads byroad broad brad bad ad
abashes abases bases bass ass as
stories stores store sore ore or
blather bather bathe bath bat at
scanted canted caned cane can ca
copings coping oping ping pin pi
cornier corner corer core cor co
managed manage mange mane man ma
tittles tittle title tile til ti
abutted butted butte butt but bu
sorters sorter sorer sore ore or
barking baring bring brig big bi
sprints sprint print pint pin pi
sliders slider slide slid lid id
curlier curler curer cure cur cu
tromped romped roped rope roe re
dotting doting doing dong don do
parsecs parsec parse pars par pa
slather lather lathe lath lat la
busbies busies buses buss bus bu
cankers canker caner cane can ca
tootled tooted toted tote tot to
bushels bushes buses buss bus bu
scrapie scrape scrap crap cap ca
mailers mailer miler mile mil mi
shatter hatter hater hate hat ha
streams stream steam seam sea ea
Sargent argent agent gent gen en
threads thread tread trad tad ta
reviler eviler viler vile vie vi
dousing dosing doing dong don do
couplet couple coupe coup cop co
emerged emerge merge mere ere er
shovels shovel shove shoe she sh
compose compos compo comp com co
heavens heaven heave have ave av
lathers lather lathe lath lat la
steamed teamed tamed tame tam ta
hastens hasten haste hast has ha
chordal choral coral coal col co
gropers groper grope rope roe re
spooled pooled poled pole pol pl
mastery master mater mate mat ma
packers packer pacer pace ace ac
tripled triple tripe trip tip ti
rangers ranger range rang ran an
bounded bonded boned bone one on
silting siting sting sing sin in
clomped comped coped cope cop co
ascents ascent scent sent sen en
Marches arches aches ache ace ac
chanter canter caner cane can ca
plashed lashed ashed shed she sh
presets preset reset rest res re
sparred spared spare spar spa pa
glitter litter liter lite lit it
rushers rusher usher user use us
couples couple coupe coup cop co
spiking piking piing ping pin pi
satraps satrap strap trap tap ta
started stared stare star tar ta
sparing spring sprig prig pig pi
sported spored spore sore ore or
scrapes scrape scrap crap cap ca
winkled winked wined wine win in
stilted silted sited site sit st
romping roping oping ping pin pi
bassets basset asset asst ass as
carouse arouse arose rose roe re
leavers leaver leave lave lav la
witches withes withe with wit wt
primped primed prime prim rim rm
ranters ranter rater rate rat rt
touches touche touch ouch och oh
sharped shared share hare are re
spilled pilled piled pile pie pi
clowned cloned clone cone con co
mushier musher usher user use us
crafted crated crate rate rat rt
scarper carper carer care car ca
shortly shorty short shot sot so
thickos thicko thick tick tic ti
bracers bracer brace race ace ac
carters carter carer care car ca
whinged whinge whine wine win in
thawing hawing awing wing win in
sweated seated sated sate sat st
meteors meteor meter mete met me
clapped capped caped cape cap ca
statute statue state stat sat st
slanted slated slate slat sat st
Eastern astern stern tern ten tn
archers arches aches ache ace ac
roughed rouged rouge roue roe re
eloping loping oping ping pin pi
groping roping oping ping pin pi
forceps forces force fore for fr
bathers bather bathe bath bat at
erasers eraser erase eras era er
blushed bushed bused used use us
trapped tapped taped tape tap ta
inspect insect inset inst ins in
gawping gaping aping ping pin pi
cannons cannon canon anon non no
cleaves cleave leave lave lav la
shields shield shied shed she sh
reflate relate elate late lat la
throngs throng thong tong ton to
swashes sashes ashes shes she sh
navvies navies naves nave ave av
demists demist deist dist dis is
honkers honker honer hone hon ho
sprouts sprout spout spot sot so
splines spline spine spin sin in
whiteys whitey white whit wit wt
drowsed drowse dowse dose dos do
lodgers lodger lodge loge log lo
spawned pawned pawed awed awe aw
spouses spouse souse sous sou so
flicked licked liked lied lid id
spewers spewer sewer ewer ewe we
chanted canted caned cane can ca
forgoer forger forge fore for fr
chewier chewer hewer ewer ewe we
planted planed plane plan pan pa
methane ethane thane than tan ta
starves starve stare star tar ta
regales regale regal real rel re
charmed harmed hared hare are re
brindle bridle bride bide bid bi
phonied phoned phone pone one on
clutter cutter cuter cute cut cu
spinets spinet spine spin sin in
caverns cavern caver cave ave av
stifles stifle stile tile til ti
loaners loaner loner lone one on
discuss discus discs disc dis is
gambles gables gales gals gas gs
sifting siting sting sing sin in
swashed washed ashed shed she sh
scorner scorer score sore ore or
coached cached cache ache ace ac
storing string sting sing sin in
gowning owning owing wing win in
brasses basses bases bass ass as
trowing towing owing wing win in
splints splint split spit sit st
tramper tamper tamer tame tam ta
spoored spored spore sore ore or
singled single singe sing sin in
arouses arouse arose rose roe re
meatier metier meter mete met me
stripey stripe strip trip tip ti
tirades tirade trade trad tad ta
brunets brunet brunt bunt bun bu
awarded warded waded wade wad ad
stripes stripe strip trip tip ti
tillers tiller tiler tile til ti
ballsed balled baled bald bad ad
cantors cantor canto cant can ca
stokers stoker stoke toke toe to
reaping raping aping ping pin pi
scourer scorer score sore ore or
stiller tiller tiler tile til ti
kludged kludge kluge luge lug lg
abridge bridge bride bide bid bi
trilled tilled tiled tile til ti
present preset reset rest res re
skewers skewer sewer ewer ewe we
scarred scared scare scar car ca
corpses corpse corps corp cor co
jounces jounce ounce once one on
pirated pirate prate prat pat pa
gestate estate state stat sat st
cowling cowing owing wing win in
spathes spathe spate spat spa pa
chooses choose chose hose hos ho
bellows bellow below blow bow ow
elapses elapse lapse laps lap la
pounces pounce ponce pone one on
barrens barren barre bare are re
relates relate elate late lat la
plusher pusher usher user use us
barging baring bring brig big bi
downier downer dower doer doe do
bridged bridge bride bide bid bi
copiers copies copes cope cop co
crowned crowed crowd crow cow co
milkers milker miler mile mil mi
mangier manger mange mane man ma
spireas spirea spire sire ire re
dossing dosing doing dong don do
grouted routed route rout rot rt
wasters waster waste wast was as
snorted snored snore sore ore or
chivies chives chive hive hie hi
Brianna Briana Brian Bran ran an
primmer primer prime prim rim rm
lounged lounge lunge lung lug lg
waddled wadded waded wade wad ad
whereon hereon heron hero her he
refused refuse reuse ruse rue re
slobbed lobbed lobed lobe lob lo
repeals repeal repel reel rel re
bonkers boners boner bone one on
ablated ablate abate bate bat at
manages manage mange mane man ma
whopped hopped hoped hope hop ho
starved starve stare star tar ta
rushier rusher usher user use us
cramped camped caped cape cap ca
busking busing using sing sin in
paining pining piing ping pin pi
washers washes ashes shes she sh
streaky streak steak teak tea ta
hungers hunger huger huge hue he
stormed stored store sore ore or
barring baring bring brig big bi
whinger whinge whine wine win in
bouncer bounce bonce bone one on
servers server serve sere ere er
noshers noshes noses nose nos no
courtly curtly curly curl cur cu
corkers corker corer core cor co
corners corner corer core cor co
pirates pirate prate prat pat pa
Martian Martin Marin Mari Mar Mr
resents resent reset rest res re
masters master mater mate mat ma
cheater heater hater hate hat ha
clinked linked lined lied lid id
sconces sconce scone cone con co
barbers barber barer bare are re
replays replay reply rely rel re
writhes writhe write writ wit wt
pastels pastel paste past pas pa
tracers tracer trace race ace ac
hopping hoping oping ping pin pi
butters butter butte butt but bu
smileys smiley smile mile mil mi
hinders hinder hider hide hid hi
loosens loosen loose loos loo lo
skewing sewing swing sing sin in
shiners shiner shine shin sin in
scarfed scared scare scar car ca
lounges lounge lunge lung lug lg
bitters bitter biter bite bit bi
cruises cruise cruse ruse rue re
peonies ponies pones pone one on
batches bathes bathe bath bat at
moussed mousse mouse muse mus mu
mincers mincer mince mine min mi
stature statue state stat sat st
jounced jounce ounce once one on
rapping raping aping ping pin pi
unities unites unite unit nit it
gnashed gashed ashed shed she sh
whitens whiten white whit wit wt
drinker dinker diner dine din in
blowing bowing owing wing win in
grander grader grade grad gad ad
busying busing using sing sin in
toilers toiler tiler tile til ti
flopped lopped loped lope lop lo
bracero bracer brace race ace ac
prestos presto pesto pest pet pt
diverse divers diver dive div iv
gripers gripes grips rips rps rs
bearing baring bring brig big bi
glasses lasses lases lass ass as
scarves scares scare scar car ca
atheist theist heist hist his hi
crowded crowed crowd crow cow co
gushers gusher usher user use us
grumble rumble ruble rube rue re
clashed cashed ashed shed she sh
lindens linens liens lens ens en
aroused arouse arose rose roe re
mammals mammal mamma mama mam ma
marshes mashes ashes shes she sh
relater relate elate late lat la
faucets faucet facet face ace ac
Jeannie Jeanie Janie Jane Jan an
rearmed reared rared rare are re
basters baster baste bast bat at
minster minter miner mine min mi
codgers codger coder code cod co
lifters lifter liter lite lit it
pupates pupate pupae pupa pup pp
smashes sashes ashes shes she sh
devices deices dices dies dis is
justifiably justified shill sill ill ll
heather heater hater hate hat ha
flashed lashed ashed shed she sh
trapper tapper taper tape tap ta
seiners seiner seine sine sin in
shorted shored shore shoe she sh
thereon hereon heron hero her he
cracked racked raced race ace ac
skivers skives skies skis sis is
splices splice spice spic pic pi
callous callus calls call cal ca
strands strand stand sand sad ad
slewing sewing swing sing sin in
parolee parole prole pole pol pl
clatter latter latte late lat la
colones colons colon coon coo co
tamping taping aping ping pin pi
triples triple tripe trip tip ti
bloated boated bated bate bat at
sparked spared spare spar spa pa
scoured scored score sore ore or
trouped troupe trope rope roe re
growing rowing owing wing win in
minters minter miner mine min mi
cantons canton canto cant can ca
pasties pastie paste past pas pa
heroine heroin heron hero her he
showing sowing swing sing sin in
planked planed plane plan pan pa
minders minder miner mine min mi
platens platen plate plat pat pa
solvers solver solve sole sol so
sexiest sexist exist exit ext ex
sheaths sheath heath heat hat ha
chloral choral coral coal col co
scorned scored score sore ore or
chorals choral coral coal col co
carries caries cares care car ca
carvery carver carve care car ca
abusers abuses buses buss bus bu
placers placer place pace ace ac
cooping coping oping ping pin pi
scoping coping oping ping pin pi
barfing baring bring brig big bi
baryons baryon baron barn ban an
pleated plated plate plat pat pa
canters canter caner cane can ca
careers career carer care car ca
emerges emerge merge mere ere er
teasers teaser tease teas tea ta
lassies lasses lases lass ass as
thready thread tread trad tad ta
winched winced wince wine win in
hoicked hocked hoked hoke hoe ho
theater heater hater hate hat ha
trouper troupe trope rope roe re
barrels barrel barre bare are re
forgers forger forge fore for fr
prisons prison prion pron pro pr
spliced splice spice spic pic pi
mantles mantes manes mane man ma
dinners dinner diner dine din in
palaces palace place pace ace ac
bursary bursar bursa burs bur bu
pareses parses parse pars par pa
slicked licked liked lied lid id
xxxviii xxxvii xxxvi xxxv xxx xx
shocked hocked hoked hoke hoe ho
stratus status stats stat sat st
fainest finest fines fine fin in
insects insect inset inst ins in
gadding adding dding ding din in
paroled parole prole pole pol pl
ashiest shiest shies shes she sh
bittier bitter biter bite bit bi
travels travel ravel rave ave av
thrusts thrust trust rust rut rt
rousted roused rouse roue roe re
touched touche touch ouch och oh
glances glance glace lace lac la
canyons canyon canon anon non no
dooming doming doing dong don do
fridges fridge ridge ride rid rd
blacked lacked laced lace lac la
similes simile smile mile mil mi
thrills thrill trill till til ti
mangles mangle mange mane man ma
combers comber comer come com co
pickers picker piker pike pie pi
sheathe sheath heath heat hat ha
threats threat treat teat tea ta
leasers leaser lease leas lea la
privets privet rivet rive riv iv
pinging pining piing ping pin pi
crocked cocked coked coed cod co
trashes rashes ashes shes she sh
tingles tingle tinge ting tin ti
charted carted cared care car ca
saluted salute saute sate sat st
chomped comped coped cope cop co
soother soothe sooth soot sot so
cruised cruise cruse ruse rue re
chowing cowing owing wing win in
greater grater grate gate ate at
drapers drapes rapes raps rps rs
tidiest tidies tides tide tie ti
frailly frilly frill fill ill ll
bellies belles belle bell ell ll
shammed shamed shame sham ham ha
tongued tonged toned tone ton to
gravies graves grave gave ave av
eviller eviler viler vile vie vi
heavies heaves heave have ave av
salutes salute saute sate sat st
gallery galley alley ally all ll
smiting siting sting sing sin in
whinier whiner whine wine win in
scraped scrape scrap crap cap ca
pinking pining piing ping pin pi
granter grater grate gate ate at
sitting siting sting sing sin in
skaters skater skate sate sat st
slatted slated slate slat sat st
pewters pewter peter peer per pr
dawning awning awing wing win in
speared spared spare spar spa pa
plainer planer plane plan pan pa
pickled picked piked pike pie pi
chaster chaste caste cast cat ca
browser browse brows brow bow ow
bravest braves brave rave ave av
coroner corner corer core cor co
aspired aspire spire sire ire re
barters barter barer bare are re
whitest whites white whit wit wt
crapped capped caped cape cap ca
shrines shrine shine shin sin in
darners darner darer dare are re
graders grader grade grad gad ad
servery server serve sere ere er
shrills justified shill sill ill ll
reveals reveal revel reel rel re
scrumpy scrump scrum scum sum um
triplex triple tripe trip tip ti
sedated seated sated sate sat st
stilled tilled tiled tile til ti
mangler mangle mange mane man ma
shinier shiner shine shin sin in
suppler supple suppl supp sup up
prawned pawned pawed awed awe aw
bridges bridge bride bide bid bi
petaled pealed paled pale pal pa
mussels musses muses muse mus mu
curdled curled cured cure cur cu
bellied belled belle bell ell ll
honesty honest hones hone hon ho
cremate create crate rate rat rt
relapse elapse lapse laps lap la
parried parred pared pare par pa
abashed bashed ashed shed she sh
seating sating sting sing sin in
teasels teasel tease teas tea ta
swerved swerve serve sere ere er
flatter latter latte late lat la
Jeanine Jeanie Janie Jane Jan an
thermos therms therm them the he
chatter hatter hater hate hat ha
loosest looses loose loos loo lo
plowing lowing owing wing win in
striped stripe strip trip tip ti
madding adding dding ding din in
matters matter matte mate mat ma
laddies ladies lades lade lad la
pounced pounce ponce pone one on
created create crate rate rat rt
coddled codded coded code cod co
passers passer passe pass pas pa
padding adding dding ding din in
warders warder wader wade wad ad
pastern astern stern tern ten tn
boinked bonked boned bone one on
pastier pastie paste past pas pa
browses browse brows brow bow ow
busiest busies buses buss bus bu
pricked priced pried pied pie pi
martins matins mains main man ma
tensest tenses tense tens ten tn
lopping loping oping ping pin pi
chasten chaste caste cast cat ca
remotes remote emote mote mot mo
scarped scared scare scar car ca
copping coping oping ping pin pi
palpate palate plate plat pat pa
avowing vowing owing wing win in
marched arched arced aced ace ac
gravels gravel grave gave ave av
rumbled rumble ruble rube rue re
chokers choker choke hoke hoe ho
scrumps scrump scrum scum sum um
stocked stoked stoke toke toe to
litters litter liter lite lit it
dashers dashes ashes shes she sh
stowing sowing swing sing sin in
worsens worsen worse wore woe we
stonier tonier toner tone ton to
gushier gusher usher user use us
cutlery cutler cuter cute cut cu
derives derive drive dive div iv
screwed screed creed cred red re
scrawly scrawl crawl craw caw ca
sprites sprite spite spit sit st


Return to “Forum Games”

Who is online

Users browsing this forum: ucim and 19 guests