A balloon problem

For the discussion of the sciences. Physics problems, chemistry equations, biology weirdness, it all goes here.

Moderators: gmalivuk, Moderators General, Prelates

User avatar
EmersonienEra
Posts: 15
Joined: Sat Jan 13, 2007 8:30 pm UTC
Location: locus, -i, m.
Contact:

A balloon problem

Postby EmersonienEra » Sat Mar 15, 2008 8:56 pm UTC

So there's an interesting story I must tell you before I ask for an explanantion.

My friend got a balloon from her boyfriend for Valentine's Day. It's a regular heart-shaped balloon filled with helium that has Dora the Explorer on it.

Now, this balloon behaved normally at first, bobbing around and stuff. My friend noticed that when you walked through the room the balloon followed you around. She figured it was because of air currents. However, when she walked from one room to another, the balloon would run into the archway above the doorways and get caught.

But this balloon (Dora, as we call her) would not be stopped. It would hit this wall and then duck down under it to go from room to room.

My friend didn't think too much about it until she woke up one morning and went into the bathroom to brush her teeth. She happened to have the hiccups, but only for a moment. She felt something brush her shoulder that startled them out of her. It was Dora! The balloon had somehow traveled past an archway and up the stairs into the bathroom past another archway overnight!

Now my friend who's a bit superstitious, left the bathroom quickly and went off to school, making sure to shut Dora into the bathroom before she left.

Later that night her brother came into the bathroom to take a shower. He noticed the balloon, but didn't mind it. He just moved it to the other side of the bathroom by the door and went about his shower. While he was showering, he heard somebody open the curtain, and turned around to see Dora had somehow opened the shower curtain... CREEPY.

But yeah. WTF???? Any explanations? Why would a balloon be able to duck under archways? Or why would it float towards someone with the hiccups? Or open a shower curtain?
When life gives you lemons, don't make a stupid signature about it.

User avatar
iamfree
Posts: 121
Joined: Fri Feb 29, 2008 5:11 pm UTC
Location: Virginia

Re: A balloon problem

Postby iamfree » Sat Mar 15, 2008 9:28 pm UTC

b/c some one is moving it...
GACAACGCACGCAACGCGCCCCGGACCACCUAA

just let It happen

User avatar
Durandal
Posts: 659
Joined: Thu Nov 08, 2007 12:12 am UTC

Re: A balloon problem

Postby Durandal » Sat Mar 15, 2008 9:42 pm UTC

It's clearly sentient and is alternately compressing and decompressing itself to lose/gain altitude, all with the aim of bobbing behind you in an annoying fashion.

User avatar
Fredd
Posts: 7
Joined: Sat Mar 15, 2008 8:49 pm UTC
Contact:

Re: A balloon problem

Postby Fredd » Sat Mar 15, 2008 10:11 pm UTC

This is just like Stephen King's "IT" but with balloons instead of clowns.
Electricity can only be replenished by whiskey. Do not argue with me, I am a Doktor.

alterant
Posts: 32
Joined: Fri Feb 15, 2008 1:34 am UTC

Re: A balloon problem

Postby alterant » Sat Mar 15, 2008 10:32 pm UTC

Sounds a bit exaggerated, but.... :)

The balloon is probably made of an insulator, and managed somehow to get some excess charge stuck on it. Insulators can be indeed *very* hard to discharge. But there is no reason for it to follow people in particular (it might just as well induce charge in a wall and attach to it), unless
a) the people are charged (which can easily happen); or
b) it wants to eat you in your sleep.

My advice would be: discharge yourself on a kitchen sink and see if it stops following. If that doesn't work, pop it. If that doesn't work, panic.

Robin S
Posts: 3579
Joined: Wed Jun 27, 2007 7:02 pm UTC
Location: London, UK
Contact:

Re: A balloon problem

Postby Robin S » Sat Mar 15, 2008 11:28 pm UTC

I think air currents probably can account for a fair bit of this behaviour.
This is a placeholder until I think of something more creative to put here.

User avatar
Mr. Beck
Commencing Countdown, Engines On
Posts: 1469
Joined: Thu Jan 24, 2008 5:14 am UTC
Location: Albuquerque, NM.

Re: A balloon problem

Postby Mr. Beck » Sun Mar 16, 2008 8:09 pm UTC

It's a charge problem. I have had balloons that would follow my hand downwards, even if fully inflated with Helium. Grounding yourself should stop the behavior.

<tangent> So, when I ordered the parts for my new computer the shipping box for the mobo was about 3 times bigger than it had to be...and the remaining space was filed with packing peanuts. I scooped the little buggers into a garbage bag with my hands, and, as you can imaging, was having difficulty due to some static charges. Eventually, I managed to get about 97% safely into the bag. While my head was inside the case, the household cat Yodapuss (don't laugh) decided that a bag full of little white round things looked like fun to jump into. He had a charge himself, and came out looking like he was battered and rolled in the peanuts. That was certainly a fun situation to remedy. </tangent>

User avatar
Matheson
Posts: 13
Joined: Sun Mar 16, 2008 2:19 pm UTC

Re: A balloon problem

Postby Matheson » Sun Mar 16, 2008 8:55 pm UTC

EmersonienEra wrote:But this balloon (Dora, as we call her) would not be stopped.


Clearly, all the years of painful research have come to fruition and you have encountered the descendent of:

Image

Or more likely ...

EmersonienEra wrote:But yeah. WTF???? Any explanations? Why would a balloon be able to duck under archways? Or why would it float towards someone with the hiccups? Or open a shower curtain?


It's probably several factors, such as static and air effects, mixed with a healthy dose of anthropomorphisation coming into play though. The hiccupping, for example, was probably incidental. The warm water of the shower probably caused a fair bit of convection and the balloon got caught in an air current, one which would have been strongest at the opening of the end of the curtain creating the illusion of Dora manoeuvring around, and so on.

User avatar
mrbaggins
Posts: 1611
Joined: Tue Jan 15, 2008 3:23 am UTC
Location: Wagga, Australia

Re: A balloon problem

Postby mrbaggins » Mon Mar 17, 2008 2:51 am UTC

Depending on just how bouyant the balloon is, it's not surprising it could dip under an archway as someone moved through it. If it zooms straight up to the ceiling and is firmly stuck there normally though, that's a rather hard force to pull down by simply walking through a nearby door.
Why is it that 4chan is either infinitely awesome, infinitely bad, or "lolwut", but never any intermediary level?

User avatar
Mr. Beck
Commencing Countdown, Engines On
Posts: 1469
Joined: Thu Jan 24, 2008 5:14 am UTC
Location: Albuquerque, NM.

Re: A balloon problem

Postby Mr. Beck » Mon Mar 17, 2008 3:11 am UTC

I just had another thought. If the balloon is up against the ceiling and a person walks underneath, the Bernoulli effect from the walking induced air currents would pull is downwards (and possibly below an arch). Then, the moving air would make it follow the moving person. Hope that makes sense.

User avatar
hipp5
Posts: 321
Joined: Tue Oct 30, 2007 4:05 am UTC
Location: Kingston, ON

Re: A balloon problem

Postby hipp5 » Mon Mar 17, 2008 4:17 am UTC

Just a guess but moving yourself through air probably creates areas of low pressure behind you. The balloon would then get pushed into the areas of low pressure. This should be sufficient to draw the balloon under the arch and also draw a balloon down with your hand waving.

btilly
Posts: 1877
Joined: Tue Nov 06, 2007 7:08 pm UTC

Re: A balloon problem

Postby btilly » Mon Mar 17, 2008 8:14 am UTC

This story reminded me of the far funnier story the horror of blimps.
Some of us exist to find out what can and can't be done.

Others exist to hold the beer.


Return to “Science”

Who is online

Users browsing this forum: No registered users and 12 guests