Insider Science Jokes/Lingo

For the discussion of the sciences. Physics problems, chemistry equations, biology weirdness, it all goes here.

Moderators: gmalivuk, Moderators General, Prelates

sgt york
Posts: 331
Joined: Mon Oct 01, 2007 7:21 pm UTC
Location: Chapel Hill, NC
Contact:

Re: Insider Science Jokes/Lingo

Postby sgt york » Thu Jul 02, 2009 2:29 pm UTC

bigglesworth wrote:Wait, I just translate that as some random sequence, and it's not divisible by 3, the reading frame's odd.

What am I missing this morning?


Heh....you put it into a software pacakge, didn't you? It would scan for the first AUG and give you
UAACAUGCUAUGAUGGAACGAACAAUUAUGGAA with the bold part as the ORF, you'd get:
RNAP wrote:AUG CUA UGA UGG AAC GAA CAA UUA UGG AA

which translates to
ribosome wrote:met-leu-val-trp-thr-glu-gln-leu-trp-WTF?
mlvwtenlw-

Do it by hand, ignoring the need for a start codon and you get...
RNAP wrote:UAA...CAUGCUAUGAUGGAACGAACAAUUAUGGAA =>
break it up into codons
UAA ... CAU GCU AUG AUG GAA CGA ACA AUU AUG GAA

Where "..." is poetic license for "pause" this translates to
ribosome on gentamicin wrote:stop...His-Ala-Met-Met-Glu-Arg-Thr-Ile-Met-Glu
or
stop...HAMMERTIME


I kind of had to do it the wrong way. You can't really have a STOP at the beginning under normal circumstances. Although I'm sure there's a joke somewhere in the fact that in thos instance you can only get to Hammertime with the use of specific antibiotics.

EDIT:
Just saw
MHD wrote:Geekiest conversation this week. right there.

heh...I think with this post we can apply for geekiest conversation of the month.

User avatar
Sartorius
Posts: 506
Joined: Sun Jul 29, 2007 6:21 am UTC
Location: Oh? Hi! Oh.

Re: Insider Science Jokes/Lingo

Postby Sartorius » Fri Jul 03, 2009 6:04 pm UTC

Are you using the one letter abbreviations?

Edit: I was ninja'd by sgt york giving the process away a long time ago.
Last edited by Sartorius on Mon Jul 27, 2009 8:21 pm UTC, edited 1 time in total.
"Give a man a fire and he's warm for the day. But set fire to him and he's warm for the rest of his life." -Terry Pratchett

User avatar
Xyros
Posts: 9
Joined: Mon Feb 16, 2009 8:03 am UTC
Location: The bottom of the center of the sun.

Re: Insider Science Jokes/Lingo

Postby Xyros » Mon Jul 06, 2009 4:35 am UTC

Due to an extreme amount of boredom, I decided to make the HAMMERTIME peptide sequence, even though there isn't a TATA box the start sequencing... Meh, ignore the formalities, that's for the liberal art majors.

Image
Tantum aliquid quisnam est bardus insisto alius.

User avatar
The EGE
not very good at pickup limes
Posts: 1081
Joined: Sat Dec 27, 2008 12:11 am UTC
Contact:

Re: Insider Science Jokes/Lingo

Postby The EGE » Tue Jul 07, 2009 4:46 am UTC

UGA... CAU GCU AUG AUG GAA CGU ACU AUC AUG GAG

Sig'd.
sillybear25 wrote:But it's NPH, so it's creepy in the best possible way.

Shivahn wrote:I'm in your abstractions, burning your notions of masculinity.

Brwagur
Posts: 81
Joined: Sat May 09, 2009 12:51 am UTC

Re: Insider Science Jokes/Lingo

Postby Brwagur » Fri Jul 10, 2009 3:08 am UTC

I built HAMMERTIME in ballview and ran some quick energy minimizations. it seems to fold rather nicely :wink:
That there is an 80's cell. See, it's got plasma legwarmers.

User avatar
dedalus
Posts: 1169
Joined: Fri Apr 24, 2009 12:16 pm UTC
Location: Dark Side of the Moon.

Re: Insider Science Jokes/Lingo

Postby dedalus » Sat Jul 11, 2009 5:16 am UTC

In terms of jokes, the usual one I've always heard is to do with the Sn2 reaction in organic chemistry. Because of the way it actually occurs (the nucleophile attacks the carbon from behind and the leaving group leaves at the same time) it's known as the 'backdoor attack', with many other puns being attached.

Oh, and for terrible:

A chemist, a biologist and a physicist go on holiday to hawaii. Whilst lying on the beach sunbaking one day, the biologist says to her other two fellows that she would really like to go out and study the marine life. She gets up, and walks into the water, however a passing shark takes her away (unbeknownst to the other two) and she dies.

Soon after, the physicist decides that he much wants to examine the very regular wave patterns, so he too goes out into the water. Unfortunately, he falls into a rip and is carried out to sea.

The chemist lies on the beach for a while, then finds a book and makes the following observation: That physicists and biologists are soluble in water.
doogly wrote:Oh yea, obviously they wouldn't know Griffiths from Sakurai if I were throwing them at them.

User avatar
Josephine
Posts: 2142
Joined: Wed Apr 08, 2009 5:53 am UTC

Re: Insider Science Jokes/Lingo

Postby Josephine » Sun Jul 12, 2009 1:45 am UTC

*Groan*
That was truly terrible. YMBA(P/B)M if that wasn't funny.
Belial wrote:Listen, what I'm saying is that he committed a felony with a zoo animal.

Salviati
Posts: 8
Joined: Thu Jul 23, 2009 11:47 pm UTC

Re: Insider Science Jokes/Lingo

Postby Salviati » Fri Jul 24, 2009 5:25 am UTC

Well as far as insider lingo goes, theres the penguin diagram when you're doing Feynman Diagrams. The story of it's naming via Wikipedia:

John Ellis was the first to refer to a certain class of Feynman diagrams as penguin diagrams, due in part to their shape, and in part to a legendary bar-room bet with Melissa Franklin. According to John Ellis:

Mary K. [Gaillard], Dimitri [Nanopoulos] and I first got interested in what are now called penguin diagrams while we were studying CP violation in the Standard Model in 1976... The penguin name came in 1977, as follows.

In the spring of 1977, Mike Chanowitz, Mary K and I wrote a paper on GUTs predicting the b quark mass before it was found. When it was found a few weeks later, Mary K, Dimitri, Serge Rudaz and I immediately started working on its phenomenology. That summer, there was a student at CERN, Melissa Franklin who is now an experimentalist at Harvard. One evening, she, I, and Serge went to a pub, and she and I started a game of darts. We made a bet that if I lost I had to put the word penguin into my next paper. She actually left the darts game before the end, and was replaced by Serge, who beat me. Nevertheless, I felt obligated to carry out the conditions of the bet.

For some time, it was not clear to me how to get the word into this b quark paper that we were writing at the time. Then, one evening, after working at CERN, I stopped on my way back to my apartment to visit some friends living in Meyrin where I smoked some illegal substance. Later, when I got back to my apartment and continued working on our paper, I had a sudden flash that the famous diagrams look like penguins. So we put the name into our paper, and the rest, as they say, is history.

http://en.wikipedia.org/wiki/Penguin_diagram


The conductance of an object (that is to say the inverse of it's resistance, which is measured in ohms and has the symbol omega) is traditionally measured in mhos (ohm spelled backwards) and has the symbol of an upside-down omega.


As far as jokes go, this one will be funny to all you Physicists out there, but not so much to everyone else.

So one day Zog, a caveman, went into see the doctor as he was becoming quite concerned about his health.

Zog: Well, it seems that everyone else at work is changing but me.

Doctor: How so, can you describe their changes?

Zog: Well, they're all standing up straighter and becoming less hairy are the biggest ones.

Doctor: Well, maybe it's something about where you live, do you live apart from all your co-workers?

Zog: No, my friend Ug lives in Shelbyville with me, and he's changing along with the rest of them.

Doctor: Well, maybe it's how you get to work, do you and Ug drive together?

Zog: No, he and I work different schedules, I get a ride in with another friend, Thag, who lives over in Hamilton.

Doctor: Well there's your problem.

Spoiler:
You'll never evolve as long as you commute with the Hamiltonian...

User avatar
LaserGuy
Posts: 4581
Joined: Thu Jan 15, 2009 5:33 pm UTC

Re: Insider Science Jokes/Lingo

Postby LaserGuy » Fri Jul 24, 2009 6:51 am UTC

Ixtellor wrote:Yesterday I learned about a computer program called "DS9"
It has something to do with anazlying data from the Chandra X-Ray observatory.

It turns out the guy who wrote it called it that for:

Deep Space Nine - an homage to Star Trek.

So if anyone else cool insider science/slightly nerdy info like that, I think you should add to the list and increased the collective knowledge base of XKCDers.


Ixtellor


If you're a data analyst in astronomy, perhaps you're familar with sextractor?

User avatar
Boxcar Aldous Huxley
Posts: 29
Joined: Sun Jan 27, 2008 2:07 am UTC
Location: Waltham, MA

Re: Insider Science Jokes/Lingo

Postby Boxcar Aldous Huxley » Wed Jul 29, 2009 9:41 pm UTC

Note that the word quark is itself an esoteric reference to Finnegan's Wake: http://en.wikipedia.org/wiki/Quark#Etymology.

No really good references in my line of work (biochem/biophys/bioinformatics), although there are some good program names, like BLAST, MUSCLE, and CHARMM. The first one can be a verb, too (BLASTing such and such a gene). Unfortunately, BLASTing "HAMMERTIME" doesn't yield any exact sequence matches, although there are a few containing "HAMMER."
"I was thrown out of NYU my freshman year. I cheated on my Metaphysics final. I looked within the soul of the boy sitting next to me." -Woody Allen

User avatar
MotorToad
Really Repeatedly Redundantly Redundant
Posts: 1114
Joined: Sat Jul 07, 2007 10:09 pm UTC
Location: Saint Joseph, CA
Contact:

Re: Science jokes

Postby MotorToad » Thu Jul 30, 2009 3:26 am UTC

sgt york wrote:
Spoiler:
And it just goes to prove, the squire of the high pot and noose is equal to the sum of the squires of the other two sides.

I hate to do this to your, uhm... "joke," but I think it proves he's greater than the sum of the squires of the other two sides. HTH! :D
What did you bring the book I didn't want read out of up for?
"MAN YOUR WAY TO ANAL!" (An actual quote from another forum. Only four small errors from making sense.)

sgt york
Posts: 331
Joined: Mon Oct 01, 2007 7:21 pm UTC
Location: Chapel Hill, NC
Contact:

Re: Science jokes

Postby sgt york » Thu Jul 30, 2009 1:06 pm UTC

MotorToad wrote:
sgt york wrote:
Spoiler:
And it just goes to prove, the squire of the high pot and noose is equal to the sum of the squires of the other two sides.

I hate to do this to your, uhm... "joke," but I think it proves he's greater than the sum of the squires of the other two sides. HTH! :D

Actually, it's a pun on several levels. The phrase "equal to the task" means you can do something.

And aren't you familiar with the old adage, (paraphrase) "You can dissect a frog and get a better understanding of it, but it doesn't do a lot of good for the frog. Much the same with a joke."

Heh...just noticed your username, too...

User avatar
Turambar
Posts: 234
Joined: Sat May 10, 2008 9:43 pm UTC

Re: Insider Science Jokes/Lingo

Postby Turambar » Fri Jul 31, 2009 2:59 am UTC

LaserGuy wrote:
Ixtellor wrote:Yesterday I learned about a computer program called "DS9"
It has something to do with anazlying data from the Chandra X-Ray observatory.

It turns out the guy who wrote it called it that for:

Deep Space Nine - an homage to Star Trek.

So if anyone else cool insider science/slightly nerdy info like that, I think you should add to the list and increased the collective knowledge base of XKCDers.


Ixtellor


If you're a data analyst in astronomy, perhaps you're familar with sextractor?

Curse you LaserGuy! I was going to mention sextractor. SExtractor, if we want to be particular.

I've used DS9 previously for astronomy stuff. Didn't know where it came from though. That's pretty sweet :)

Currently I'm using a program called AIPS to process data from the Very Large Array. The manual for this program is called the AIPS cookbook, and at the end it has nineteen pages of banana recipes. Pretty great. Also, if there are blank pixels in your data, it fills them in with values that are multiples of pi.

Gordon Freeman of Half Life fame is named after astrophysicist Freeman Dyson, the guy who thought up the incredibly awesome Dyson Sphere.
"Physics is like sex. Sure, it may give some practical results, but that's not why we do it."
--Richard Feynman

Walter.Horvath
Posts: 933
Joined: Fri May 15, 2009 11:33 pm UTC
Location: Orlando, FL

Re: Insider Science Jokes/Lingo

Postby Walter.Horvath » Fri Jul 31, 2009 4:19 am UTC

qetzal wrote:The existence of stop codons in protein coding sequences in DNA was first determined in genetic experiments performed by Harris Bernstein. He found so-called nonsense mutations. The first ones were called "amber" mutations because Bernstein means amber in German. Later, it was found the that amber mutation corresponds to one of the three stop codons, TAG (or UAG in RNA). When the other two stop codons were discovered, they were named ochre (TAA) and opal (TGA) to maintain the color theme.

Wow, I just can't think of any situation in where nobody would know that stop codons existed. Things that would have tipped me off were I him include it being one of two letter combinations, and being at the end of a strand of useful codons.

Maybe that's just a benefit of hindsight.

User avatar
MotorToad
Really Repeatedly Redundantly Redundant
Posts: 1114
Joined: Sat Jul 07, 2007 10:09 pm UTC
Location: Saint Joseph, CA
Contact:

Re: Insider Science Jokes/Lingo

Postby MotorToad » Fri Jul 31, 2009 1:31 pm UTC

Just thought of one... In reactor controls lingo a "scram" is a total instant shutdown of the reactor for safety reasons, accomplished by dropping all of the control rods into the core. Legend has it that early prototype reactors had the rods supported by ropes (entirely possible as they were tiny little reactors) and the "scram" was the "Safety Control Rod Axe Man."
What did you bring the book I didn't want read out of up for?
"MAN YOUR WAY TO ANAL!" (An actual quote from another forum. Only four small errors from making sense.)

User avatar
bigglesworth
I feel like Biggles should have a title
Posts: 7461
Joined: Sat Apr 07, 2007 9:29 pm UTC
Location: Airstrip One

Re: Insider Science Jokes/Lingo

Postby bigglesworth » Fri Jul 31, 2009 10:45 pm UTC

In the famous squash court reactor, the control rods were indeed activated by person with axe. Though that proves nothing about "scram".
Generation Y. I don't remember the First Gulf War, but do remember floppy disks.

qetzal
Posts: 862
Joined: Thu May 01, 2008 12:54 pm UTC

Re: Insider Science Jokes/Lingo

Postby qetzal » Fri Jul 31, 2009 11:16 pm UTC

Walter.Horvath wrote:Wow, I just can't think of any situation in where nobody would know that stop codons existed.


One very possible alternative at the time was that translation simply stopped when it reached the end of the mRNA.

Things that would have tipped me off were I him include it being one of two letter combinations, and being at the end of a strand of useful codons.

Maybe that's just a benefit of hindsight.


Amber mutants were identified & named in about 1960. This was all way before anyone could sequence genes. In fact, when they were named, there was no real understanding of what they did. They were discovered using phage genetics and complementation assays. Basically, they were a whole class of mutations in different genes that could be suppressed in certain hosts. We now know that the suppression is because some E. coli have mutated tRNAs that recognize the stop codons and insert an amino acid there, allowing translation to 'read through' what would otherwise be a stop.

User avatar
Charlie!
Posts: 2035
Joined: Sat Jan 12, 2008 8:20 pm UTC

Science Jokes

Postby Charlie! » Tue Aug 04, 2009 6:07 am UTC

A woman in liquor production
Owns a still of exquisite construction.
The alcohol boils
Through magnetic coils.
She says that it's "proof by induction."
Last edited by Charlie! on Tue Aug 04, 2009 6:13 am UTC, edited 1 time in total.
Some people tell me I laugh too much. To them I say, "ha ha ha!"

User avatar
Josephine
Posts: 2142
Joined: Wed Apr 08, 2009 5:53 am UTC

Re: Insider Science Jokes/Lingo

Postby Josephine » Tue Aug 04, 2009 6:09 am UTC

Charlie! wrote:A woman in liquor production
Owns a still of exquisite construction.
The alcohol boils
Through magnetic coils.
She says that it's "proof by induction."


*groan*
Belial wrote:Listen, what I'm saying is that he committed a felony with a zoo animal.

User avatar
Sungura
When life gives you banananas, make bananana bread
Posts: 3916
Joined: Sat Jan 12, 2008 2:32 am UTC
Location: AL

Re: Insider Science Jokes/Lingo

Postby Sungura » Thu Sep 10, 2009 3:19 pm UTC

I wrote a pun. It is sciency.

Synthesizing puns is certainly no elemental practice. It takes hard work to get the proper reaction. Otherwise, it all decomposes. If refluxed together properly, adol adds up in the eyne-d. Ester is a master at this but sometimes Fryes her Rearangement and combusts. When it goes down the tubes, she just vortexes a Pinacol-ada for some yummy alcohol.
"Would you rather fight a Sungura-sized spider or 1000 spider-sized Sunguras?" -Zarq
she/<any gender neutral>/snug

DrZiro
Posts: 132
Joined: Mon Feb 09, 2009 3:51 pm UTC

Re: Insider Science Jokes/Lingo

Postby DrZiro » Fri Sep 11, 2009 9:21 pm UTC

Among the really old ones, there's that plant which Linnaeus named after one of his colleagues, whom he didn't like - it seems nice to name a plant after someone, but apparently the plant had a tiny... flower, thing.

Another old one: When Newton wrote in the foreword of Principia
"If I have seen farther than others, it is because I was standing on the shoulders of giants"
he was actually dissing Robert Hooke, another famous physicist. Hooke was very short.

An unintentional funny thing is the Lorentz–Lorenz Equation, named after two scientists with only slightly different names. Then of course we have the very aptly named Poynting Vector, and the somewhat less known Killing Field.

User avatar
bigglesworth
I feel like Biggles should have a title
Posts: 7461
Joined: Sat Apr 07, 2007 9:29 pm UTC
Location: Airstrip One

Re: Insider Science Jokes/Lingo

Postby bigglesworth » Sat Sep 12, 2009 10:29 am UTC

A tiny stamen?

In Kim Stanley Robinson's new book about Galileo he is transported to the future... then when the course of mathematics and science is explained to him he says "If I have not seen so far as others it is because I have stood on the shoulders of dwarfs" :mrgreen:
Generation Y. I don't remember the First Gulf War, but do remember floppy disks.

brazen
Posts: 4
Joined: Wed Sep 16, 2009 7:42 am UTC

Re: Insider Science Jokes/Lingo

Postby brazen » Thu Sep 17, 2009 4:44 am UTC

A joke I got from a grad student I worked with:

Heisenberg is driving a car and is speeding quite excessively,
He get's pulled over by a police officer who asks,
"Do you know how fast you were going?"
To which Heisenberg replied,
"No, but I know exactly where I am."

Poisson's spot:

Image

Actually the story behind this is pretty funny. Apparently Poisson tried to disprove the wave nature of light by theorizing there would have to be a bright spot on a metal disk opposite a light source due to interference. Eventually a fellow named Arago did the experiment and found the spot. To this day the spot is ironically called the Poisson spot (and Arago spot too.. but I learned it as the Poisson spot).

Also learned about RIP, or replication initiation point mapping for finding exactly where origins of DNA replication are. Thought it was amusing.

User avatar
roundedge
Posts: 167
Joined: Wed Jun 20, 2007 3:53 am UTC
Location: White Rock, BC, Canada

How do you do it?

Postby roundedge » Thu Sep 17, 2009 10:16 am UTC

The first three my friend sent me:

Astrophysicists appear to do it at a furious rate due to the effects of time dilation.

String theorists cannot agree on how to do it but are all certain it is very complicated.

Black hole cosmologists cannot tell you how they do it because the information is only released as Hawking radiation over billions of years.

apparently from jeph jacques' twitter feed

The rest are mine:

Quantum physicists are too small to do it.

Pancomputationalists seem to think it's the same thing they do on the computer.

Astronomers never get any sleep because of it.

Particle physicists always end up doing it with a crowd.

Solipsists can never find a partner.

Young earth creationists condemn it entirely.

Celarion
Posts: 1
Joined: Thu Nov 19, 2009 11:35 am UTC

Groaners here!

Postby Celarion » Thu Nov 19, 2009 11:38 am UTC

What did the positron say to the electron as it was ejected from the former neutron?

You should b+!

And was subsequently beaten down by it's new bigger brother. Because that's what alphas are good for.

User avatar
meat.paste
Posts: 404
Joined: Fri Apr 25, 2008 3:08 pm UTC

Re: Insider Science Jokes/Lingo

Postby meat.paste » Fri Nov 20, 2009 5:49 pm UTC

One from my field is "Electron Impact Excitation of Ions from Organics" or EIEIO.
Huh? What?

User avatar
bigglesworth
I feel like Biggles should have a title
Posts: 7461
Joined: Sat Apr 07, 2007 9:29 pm UTC
Location: Airstrip One

Re: Insider Science Jokes/Lingo

Postby bigglesworth » Fri Nov 20, 2009 6:16 pm UTC

That's really cool :D
Generation Y. I don't remember the First Gulf War, but do remember floppy disks.

User avatar
Phoenix112358
Posts: 133
Joined: Wed Dec 03, 2008 12:39 pm UTC
Location: New Zealand

Re: Insider Science Jokes/Lingo

Postby Phoenix112358 » Sat Nov 21, 2009 7:05 am UTC

[innuendo] Would you like to draw your substrate into my active site? [/innuendo]

User avatar
modularblues
Posts: 689
Joined: Sun Nov 08, 2009 8:33 am UTC
Location: Escher's Wonderland
Contact:

Re: Insider Science Jokes/Lingo

Postby modularblues » Sat Nov 21, 2009 8:38 am UTC

QM prof: "When a wave reaches a hard boundary, it will phase-shift 180 degrees. I will now demonstrate."

(Prof takes off glasses) "This might hurt."

(He walks into a wall)

"I have just experienced a 180-degree face-shift."

User avatar
Senefen
Posts: 162
Joined: Thu Mar 29, 2007 5:09 am UTC

Re: Insider Science Jokes/Lingo

Postby Senefen » Sun Nov 22, 2009 6:32 am UTC

That meteor, Apophis, that scientists were worried might hit us in 2029? Named after the stargate villian.
ImageImageImageImageImage

cptnoob
Posts: 5
Joined: Thu Nov 12, 2009 9:09 pm UTC

Re: Insider Science Jokes/Lingo

Postby cptnoob » Wed Dec 09, 2009 6:00 am UTC

I read in an astronomy book about a comet named NEAT.
I thought it was pretty funny.

User avatar
You, sir, name?
Posts: 6983
Joined: Sun Apr 22, 2007 10:07 am UTC
Location: Chako Paul City
Contact:

Re: Insider Science Jokes/Lingo

Postby You, sir, name? » Wed Dec 09, 2009 6:58 am UTC

brazen wrote:Heisenberg is driving a car and is speeding quite excessively,
He get's pulled over by a police officer who asks,
"Do you know how fast you were going?"
To which Heisenberg replied,
"No, but I know exactly where I am."


This joke never made sense to me. If his momentum was observed to a high degree of accuracy, the uncertainty in momentum applies to all observers. So how can the cop mysteriously determine that he is speeding?!
I edit my posts a lot and sometimes the words wrong order words appear in sentences get messed up.

User avatar
SlyReaper
inflatable
Posts: 8015
Joined: Mon Dec 31, 2007 11:09 pm UTC
Location: Bristol, Old Blighty

Re: Insider Science Jokes/Lingo

Postby SlyReaper » Wed Dec 09, 2009 10:42 am UTC

You, sir, name? wrote:
brazen wrote:Heisenberg is driving a car and is speeding quite excessively,
He get's pulled over by a police officer who asks,
"Do you know how fast you were going?"
To which Heisenberg replied,
"No, but I know exactly where I am."


This joke never made sense to me. If his momentum was observed to a high degree of accuracy, the uncertainty in momentum applies to all observers. So how can the cop mysteriously determine that he is speeding?!


You're not making any sense. I think one of your "momentum"s needs to be replaced by a "position".
Image
What would Baron Harkonnen do?

User avatar
PM 2Ring
Posts: 3707
Joined: Mon Jan 26, 2009 3:19 pm UTC
Location: Sydney, Australia

Re: Insider Science Jokes/Lingo

Postby PM 2Ring » Wed Dec 09, 2009 2:00 pm UTC

If his momentum was observed to a high degree of accuracy, the uncertainty in momentum applies to all observers. So how can the cop mysteriously determine that he is speeding?!

Fair point, but what makes you think the cop knows Heisenberg's speed with any degree of certainty? Sure, cops normally only pull people over when they believe the person is speeding. But this is a joke, and unexpected shifts of logic are certainly permissable. :)

User avatar
AwesomeJosh
Posts: 50
Joined: Mon Nov 30, 2009 2:16 pm UTC
Location: Washington DC

Re: Insider Science Jokes/Lingo

Postby AwesomeJosh » Thu Dec 10, 2009 10:12 pm UTC

I came up with one around Halloween this year that nobody really seemed to like, but I thought it was hilarious :(

Why did the ghost decide to learn quantum physics?

Spoiler:
He heard there was spooky action at a distance!

stargazer1963
Posts: 1
Joined: Mon Feb 01, 2010 9:18 am UTC

Re: Insider Science Jokes/Lingo

Postby stargazer1963 » Mon Feb 01, 2010 9:22 am UTC

What's the "3-degree background" in astrophysics?

Spoiler:
No guarantee of a job.

User avatar
Korandder
Posts: 161
Joined: Fri Sep 14, 2007 6:12 am UTC
Location: LoadingReadyRun Australian Astrophysical Observatory
Contact:

Re: Insider Science Jokes/Lingo

Postby Korandder » Tue Feb 02, 2010 12:07 am UTC

Ixtellor wrote:Yesterday I learned about a computer program called "DS9"
It has something to do with anazlying data from the Chandra X-Ray observatory.

It turns out the guy who wrote it called it that for:

Deep Space Nine - an homage to Star Trek.

So if anyone else cool insider science/slightly nerdy info like that, I think you should add to the list and increased the collective knowledge base of XKCDers.


Ixtellor


DS9 is the third version of SAOimage which is a common image display program used in astronomy. The first version was known only as SAOimage, the second version as SAOimage: The Next Generation and the third and current version is known as SAOimage: Deep Space 9.
Image

mercutio_stencil
Posts: 293
Joined: Tue Feb 02, 2010 8:36 pm UTC

Re: Insider Science Jokes/Lingo

Postby mercutio_stencil » Thu Feb 04, 2010 4:59 pm UTC

Sungura wrote:I wrote a pun. It is sciency.

Synthesizing puns is certainly no elemental practice. It takes hard work to get the proper reaction. Otherwise, it all decomposes. If refluxed together properly, adol adds up in the eyne-d. Ester is a master at this but sometimes Fryes her Rearangement and combusts. When it goes down the tubes, she just vortexes a Pinacol-ada for some yummy alcohol.


my dear sir, puns are like steaks, they're a rare medium well done.

User avatar
Meteorswarm
Posts: 979
Joined: Sun Dec 27, 2009 12:28 am UTC
Location: Ithaca, NY

Re: Insider Science Jokes/Lingo

Postby Meteorswarm » Thu Feb 04, 2010 11:39 pm UTC

Why do protestant churches travel only at the speed of light?
Spoiler:
Because they have no mass
The same as the old Meteorswarm, now with fewer posts!

User avatar
Sir_Elderberry
Posts: 4206
Joined: Tue Dec 04, 2007 6:50 pm UTC
Location: Sector ZZ9 Plural Z Alpha
Contact:

Re: Insider Science Jokes/Lingo

Postby Sir_Elderberry » Mon Feb 08, 2010 5:50 pm UTC

Korandder wrote:image which is a common image display program used in astronomy. The first version was known only as SAOimage, the second version as SAOimage: The Next Generation and the third and current version is known as SAOimage: Deep Space 9.

Problem is, they're out of good Trek series now. SAOImage: Voyager won't be nearly as popular.
http://www.geekyhumanist.blogspot.com -- Science and the Concerned Voter
Belial wrote:You are the coolest guy that ever cooled.

I reiterate. Coolest. Guy.

Well. You heard him.


Return to “Science”

Who is online

Users browsing this forum: No registered users and 17 guests